An increase in ER stress and unfolded protein response in iPSCs-derived neuronal cells from neuronopathic Gaucher disease patients.

Gaucher disease (GD) is a lysosomal storage disorder caused by a mutation in the GBA1 gene, responsible for encoding the enzyme Glucocerebrosidase (GCase). Although neuronal death and neuroinflammation have been observed in the brains of individuals with neuronopathic Gaucher disease (nGD), the exact mechanism underlying neurodegeneration in nGD remains unclear. In this study, we used two induced pluripotent stem cells (iPSCs)-derived neuronal cell lines acquired from two type-3 GD patients (GD3-1 and GD3-2) to investigate the mechanisms underlying nGD by biochemical analyses. These iPSCs-derived neuronal cells from GD3-1 and GD3-2 exhibit an impairment in endoplasmic reticulum (ER) calcium homeostasis and an increase in unfolded protein response markers (BiP and CHOP), indicating the presence of ER stress in nGD. A significant increase in the BAX/BCL-2 ratio and an increase in Annexin V-positive cells demonstrate a notable increase in apoptotic cell death in GD iPSCs-derived neurons, suggesting downstream signaling after an increase in the unfolded protein response. Our study involves the establishment of iPSCs-derived neuronal models for GD and proposes a possible mechanism underlying nGD. This mechanism involves the activation of ER stress and the unfolded protein response, ultimately leading to apoptotic cell death in neurons.

A novel AP1S2 variant causing leaky splicing in X-linked intellectual disability: Further delineation and intrafamilial variability.

Pettigrew syndrome (PGS), an X-linked intellectual disability (XLID), is caused by mutations in the AP1S2 gene. Herein, we described a Thai family with six patients who had severe-to-profound intellectual impairment, limited verbal communication, and varying degrees of limb spasticity. One patient had a unilateral cataract. We demonstrated facial evolution over time, namely coarse facies, long faces, and thick lip vermilions. We identified a novel AP1S2 variant, c.1-2A>G. The mRNA analysis revealed that the variant resulted in splicing defects with leaky splicing, yielding two distinct aberrant transcripts, one of which likely resulting in the mutant protein lacking the first 44 amino acids whereas the other possibly leading to no production of the protein. By performing a literature review, we found 51 patients and 11 AP1S2 pathogenic alleles described and that all the variants were loss-of-function alleles. The severity of ID in Pettigrew syndrome is mostly severe-to-profound (54.8%), followed by moderate (26.2%) and mild. Progressive spasticity was noted in multiple patients. In summary, leaky splicing found in the present family was likely related to the intrafamilial clinical variability. Our data also support the previous notion of variable expression and neuroprogressive nature of the disorder.

Establishment of MUi030-A: A human induced pluripotent stem cell line carrying homozygous L444P mutation in the GBA1 gene to study type-3 Gaucher disease.

Gaucher disease (GD) is a common lysosomal storage disease resulting from mutations in the glucocerebrosidase (GBA1) gene. This genetic disorder manifests with symptoms affecting multiple organs, yet the underlying mechanisms leading to pathology remain elusive. In this study, we successfully generated the MUi030-A human induced pluripotent stem cell (hiPSC) line using a non-integration method from a male type-3 GD patient with a homozygous c.1448T>C (L444P) mutation. These hiPSCs displayed a normal karyotype and pluripotency markers and the remarkable ability to differentiate into cells representing all three germ layers. This resourceful model holds significant promise for illuminating GD's underlying pathogenesis.

Parental Awareness, Knowledge, and Attitudes Regarding Current and Future Newborn Bloodspot Screening: The First Report from Thailand.

Newborn screening (NBS) is a public health service that is used to screen for treatable conditions in many countries, including Thailand. Several reports have revealed low levels of parental awareness and knowledge about NBS. Because of limited data on parental perspectives toward NBS in Asia and the differences in socio-cultural and economic contexts between Western and Asian countries, we conducted a study to explore parental perspectives on NBS in Thailand. A Thai questionnaire to assess awareness, knowledge, and attitudes regarding NBS was constructed. The final questionnaire was distributed to pregnant women, with or without their spouses, and to parents of children aged up to one year who visited the study sites in 2022. A total of 717 participants were enrolled. Up to 60% of parents were identified as having good awareness, which was significantly associated with gender, age, and occupation. Only 10% of parents were classified as having good knowledge relative to their education level and occupation. Providing appropriate NBS education should be initiated during antenatal care, focusing on both parents. This study noted a positive attitude toward expanded NBS for treatable inborn metabolic diseases, incurable disorders, and adult-onset diseases. However, modernized NBS should be holistically evaluated by multiple stakeholders in each country because of different socio-cultural and economic contexts.

Response to Prolonged Duration of Therapeutic Dose Oral Iron Therapy in a Girl With Novel TMPRSS6 Gene Variants: A Case Report and Review Literature.

Iron-refractory iron deficiency anemia (IRIDA) is an autosomal recessive disorder caused by mutations in the TMPRSS6 gene, which impair iron homeostasis. We reported a 4-year-old girl who presented with a 1-year history of iron deficiency anemia. Her hemoglobin level increased from 6.5 g/dL to 12.6 g/dL with a prolonged duration of therapeutic dose oral iron therapy (5 mg/kg/d), and the level remained quite stable during the therapy. Genetic analysis of the TMPRSS6 gene revealed compound heterozygotes of 2 novel pathogenic variants: c.811C> T (NM_153609.3) in exon 7 (NP_705837: p.R271Ter) and c.1254C> G in exon 11 (p.Y418Ter). The results highlight the significance of genetic investigation and long-term iron therapy in iron-refractory iron deficiency anemia patients.

Phenotypic and molecular features of Thai patients with primary carnitine deficiency.

BACKGROUND: Primary carnitine deficiency (PCD) is screened by expanded newborn screening (NBS) using tandem mass spectrometry (MS/MS) that can detect both affected neonates and mothers. This study aimed to delineate the clinical, biochemical, and molecular findings of Thai PCD patients. METHODS: Expanded NBS using MS/MS was implemented in Bangkok and 146,757 neonates were screened between 2014 and 2018. PCD was screened by low free carnitine (C0) levels in dried blood spots. Plasma C0 levels and C0 clearance values were measured in neonates and their mothers with positive screening results. Clinically diagnosed cases were described. The coding regions and intron-exon boundaries of the SLC22A5 gene were sequenced in all cases with low plasma C0 levels. RESULTS: There were 14 cases with confirmed PCD: two clinically diagnosed cases, and 12 cases identified through NBS including five newborns, six mothers, and one older sibling. Thus, the incidence of PCD in neonates was 1:29,351. All affected neonates and mothers were asymptomatic except one mother with dilated cardiomyopathy. SLC22A5 gene sequencing identified biallelic causative variants in all cases, comprising 10 different variants of which four were novel. c.51C > G (p.Phe17Leu) and c.760C > T (p.Arg254Ter) were the most prevalent variants in this study. Cases with significant clinical features tended to have higher C0 clearance values. CONCLUSIONS: Primary carnitine deficiency is a common inherited metabolic disorder (IMD) in Thailand. Our findings broaden the spectrum of SLC22A5 variants. The future national NBS program will shed more light on PCD and other IMDs in Thailand.

Comprehensive and long-term outcomes of enzyme replacement therapy followed by stem cell transplantation in children with Gaucher disease type 1 and 3.

BACKGROUND: Gaucher disease (GD) is a lysosomal storage disorder, characterized by hepatosplenomegaly, pancytopenia, bone diseases, with or without neurological symptoms. Plasma glucosylsphingosine (lyso-Gb1), a highly sensitive and specific biomarker for GD, has been used for diagnosis and monitoring the response to treatment. Enzyme replacement therapy (ERT) is an effective treatment for the non-neurologic symptoms of GD. Neuronopathic GD (type 2 and 3) accounts for 60%-70% of the Asian affected population. METHODS: We explored combination therapy of ERT followed by hematopoietic stem cell transplantation (HSCT) and its long-term outcomes in patients with GD type 3 (GD3). RESULTS: Four patients with GD3 and one with GD type 1 (GD1) underwent HSCT. The types of donor were one matched-related, one matched-unrelated, and three haploidentical. The age at disease onset was 6-18 months and the age at HSCT was 3.8-15 years in the patients with GD3. The latest age at follow-up was 8-22 years, with a post-HSCT duration of 3-14 years. All patients had successful HSCT. Chronic graft-versus-host disease occurred in one patient. The enzyme activities were normalized at 2 weeks post HSCT. Lyso-Gb1 concentrations became lower than the pathological value. All of the patients are still alive and physically independent. Most of them (4/5) returned to school. None of the patients with GD3 had seizures or additional neurological symptoms after HSCT, but showed varying degrees of cognitive impairment. CONCLUSIONS: ERT followed by HSCT could be considered as an alternative treatment for patients with GD3 who have a high risk of fatal neurological progression.

Effects of gentamicin inducing readthrough premature stop Codons: A study of alpha-L-iduronidase nonsense variants in COS-7 Cells.

Mucopolysaccharidosis type I Hurler syndrome (MPS IH) is a severe lysosomal storage disorder caused by alpha-l-iduronidase (IDUA) deficiency. Premature truncation mutations (PTC) are the most common (50%-70%) type of IDUA mutations and correlate with MPS IH. Nonsense suppression therapy is a therapeutic approach that aims to induce stop codon readthrough. The different ability of gentamicin to bind mutant mRNA in readthrough is determined by nucleotide sequence (PTC context: UGA > UAG > UAA) and inserted amino acid including the nucleotide position +4 of the PTC, as well as the mRNA secondary structure. We used COS-7 cells to investigate the functional characteristics of p.Q500X and p.R619X, IDUA variants and the effects of gentamicin in inducing stop codon readthrough of seven IDUA variants including p.Q500X, p.R619X, p.Q70X, p.E299X, p.W312X, p.Q380X, and p.W402X. Moreover, we performed prediction of RNA secondary structure using the online tool RNAfold. We found that cells treated with gentamicin showed significantly enhanced full-length IDUA expression and restored IDUA activity, in a dose-dependent manner, only in cells expressing cDNA with W312X, Q380X, W402X, and R619X. Among the readthrough-responsive variants, we observed UGA PTC in W312X, W402X and R619X; and UAG PTC with C at nucleotide +4 in Q380X. Changes of RNA secondary structure were noted only in mutants with readthrough-responsive variants including W312X, Q380X, W402X, and R619X. Additional preclinical studies of selected PTCs with potential readthrough, using drugs with less oto-nephrotoxicity, in patient's skin fibroblasts and animal model are necessary for the premise of personalized medicine.

Association of Mitochondrial DNA Polymorphisms With Pediatric-Onset Cyclic Vomiting Syndrome.

Background: Cyclic vomiting syndrome (CVS) is a functional gastrointestinal disorder characterized by recurrent stereotypic episodes of vomiting. The pathophysiology of CVS remains obscure. Previous studies have supported the hypotheses of mitochondrial dysfunction. However, data on association studies between mitochondrial DNA (mtDNA) polymorphisms and pediatric-onset CVS are limited and inconsistent. The aims of this study were to describe clinical characteristics, evaluate association of mtDNA polymorphisms 16519T and 3010A with pediatric-onset CVS and identify new mtDNA candidate variants. Methods: This study involved Thai patients diagnosed with CVS according to the Rome III or IV criteria before the age of 15 years. Patients' demographic data, clinical characteristics, previous investigations and treatment outcomes were obtained. Blood samples were collected for next-generation (whole exome) sequencing, followed by analysis of chromosome M (mitochondrial. Variants were filtered according to clinical significance using ClinVar and MITOMAP. mtDNA polymorphisms in 148 normal Thai individuals were used as controls. Results: Forty-eight children were enrolled in the clinical study, and 30 participated in the genetic analysis. The median age at onset and median age at diagnosis was 3.0 (1.5-5.6) and 6.3 (3.0-8.6) years, respectively. Maternal history of migraine was positive in 16.7%. About 45.7% (21 of 46) of the patients achieved complete clinical remission, with the mean symptom duration of 5.9 ± 3.3 years. The prevalence of mtDNA variants 16519T and 3010A among the patient group and Thai general population (control) were as follows: 40.0% (12/30) vs. 27.7% (P = 0.18) and 6.7% (2/30) vs. 0.7% (P = 0.07), respectively. Five known pathogenic variants were identified in 6 patients, including mtDNA 8528C in one patient who also had infantile hypertrophic cardiomyopathy. Six likely pathogenic variants were found but without statistical significance. We identified 11 variants with significant prevalence in the patient group. Though, these variants were classified as variants of unknown significance (VUS), several of them were located in mt functional regions and therefore they deserve further investigations as new candidates for association with pediatric CVS. Conclusion: There were no associations of mtDNA polymorphisms 16519T and 3010A with CVS in our pediatric cohort. Five pathogenic variants and 11 VUS were found associated with pediatric-onset CVS.

Etiology and outcome of acute recurrent pancreatitis and chronic pancreatitis.

BACKGROUND: Owing to the lack of data, we aimed to determine the etiology and outcome of acute recurrent pancreatitis (ARP) and chronic pancreatitis (CP) in children in Southeast Asia. METHODS: This retrospective study was conducted at a university hospital in Bangkok, Thailand. We included patients aged <18 years who were diagnosed with pancreatitis from 2000 to 2021. RESULTS: Among 155 patients with pancreatitis, 21 (13.5%) were diagnosed with either ARP (n = 7) or CP (n = 14). Clinical manifestations of CP included chronic abdominal pain (n = 10, 71.4%), steatorrhea (n = 8, 57.1%), and diabetes mellitus (n = 1, 7.1%). Positive radiological findings compatible with CP were detected from an abdominal ultrasound, computed tomography, magnetic resonance cholangiopancreatography in 70%, 90.9%, and 92.9% of patients, respectively. Genetic, metabolic, and pancreaticobiliary causes were the major causes of ARP/CP (23.8% each) and the etiologies were unidentified in one-fifth of the patients. Patients with metabolic diseases who had AP were at-risk of developing ARP (hazards ratio [HR], 4.7, 95% confidence interval [CI]: 1.5-13.9). Children with ARP or CP were younger than those with AP (P = 0.04). Approximately two-thirds of patients with CP had growth faltering and they had more episodes of hospitalization due to acute attacks when compared to patients with ARP ( 4 [interquartile range [IQR], 3-6] vs. 3 [IQR, 2-3]; P = 0.02). CONCLUSION: Genetic, metabolic, and pancreaticobiliary diseases were the common etiologies of ARP and CP among children living in a developing country in Southeast Asia. The burden of CP included malnutrition and frequent hospitalization. The findings emphasize the importance of an early etiological diagnosis and monitoring for pancreatic insufficiency in ARP/CP.

Epidermolysis Bullosa With Congenital Absence of Skin: Congenital Corneal Cloudiness and Esophagogastric Obstruction Including Extended Genotypic Spectrum of PLEC, LAMC2, ITGB4 and COL7A1.

Epidermolysis bullosa (EB) is a rare and genetically heterogeneous disorder characterized by skin fragility and blister formation occurring spontaneously or after minor trauma. EB is accompanied by congenital absence of skin (EB with CAS) in some patients. Pathogenic variants of COL7A1 are responsible for EB with CAS in the vast majority of cases. Type and subtype diagnosis of EB with CAS generally requires specific immunohistological examinations that are not widely available plus targeted gene analysis. The present study aimed to determine the clinical features of five patients affected by EB with CAS and to identify the underlying genetic defects using whole exome sequencing (WES) followed by focused analysis of the target genes. Four patients had generalized skin involvement and one had localized defects. Two patients exhibited extremely severe skin manifestations and congenital cloudy cornea along with pyloric atresia, and one had partial esophagogastric obstruction and anuria due to vesicoureteric obstruction. In the WES analysis, the average coverage of the target exons was 99.05% (726 of 733 exons), with a range of 96.4-100% for individual genes. We identified four novel and two known pathogenic/likely pathogenic variants of five distinct genes in the examined families: PLEC:c.2536G > T (p.Glu846Ter); LAMC2:c.3385C > T (p.Arg1129Ter); KRT5:c.429G > A (p.Glu477Lys); ITGB4:c.794dupC (p.Ala266SerfsTer5); COL7A1:c.5440C > T (p.Arg1814Cys); and COL7A1:c.6103delG. All alleles were inherited from the parents, except for the KRT5 variant as a de novo finding. The findings reveal extremely rare phenotypes found in EB with CAS, namely congenital cloudy cornea, esophagogastric obstruction, and anuria, and extend the genotypic spectrum of EB-related genes. The data confirm that WES provides very high coverage of coding exons/genes and support its use as a reasonable alternative method for diagnosis of EB. The present data from an underrepresented population in Southeast Asia could further broaden the knowledge and research on EB.

A novel TCN2 mutation with unusual clinical manifestations of hemolytic crisis and unexplained metabolic acidosis: expanding the genotype and phenotype of transcobalamin II deficiency.

BACKGROUND: Transcobalamin deficiency is a rare inborn metabolic disorder, characterized by pancytopenia, megaloblastic anemia, failure to thrive, diarrhea, and psychomotor retardation. CASE PRESENTATION: We describe a patient who first presented at 3 months of age, with pancytopenia, hepatosplenomegaly, recurrent infection, metabolic acidosis, and acute hemolytic crisis. Extensive hematologic and immunologic investigations did not identify inherited bone marrow failure syndrome, acute leukemia or its related disorders. Whole exome sequencing identified a novel homozygous TCN2 mutation, c.428-2A > G and mRNA study confirmed an aberrant transcription of exon 4 skipping. The mutant protein is predicted to have an in-fame 51 amino acids deletion (NP_000346:p.Gly143_Val193del). The patient exhibited marked clinical improvement following hydroxocobalamin treatment. CONCLUSIONS: Transcobalamin deficiency should be investigated in infants with unexplained pancytopenia and acute hemolytic crisis with or without typical evidence of vitamin B12 deficiency.

A generation of human induced pluripotent stem cell line (MUi031-A) from a type-3 Gaucher disease patient carrying homozygous mutation on GBA1 gene.

Gaucher disease (GD) is one of the most prevalent lysosomal storage diseases caused by mutation of glucocerebrosidase (GBA1) gene. GD patients develop symptoms in various organs of the body; however, the underlying mechanisms causing pathology are still elusive. Thus, a suitable disease model is important in order to facilitate subsequent investigations. Here, we established MUi031-A human induced pluripotent stem cell (hiPSC) line from CD34+ hematopoietic stem cells of a female type-3 GD patient with homozygous c.1448 T > C (L444P) mutation. The cells exhibited embryonic stem cell-like characteristics and expressed pluripotency markers with capability to differentiate into three germ layers.

Central Precocious Puberty in a Boy with Pseudohypoparathyroidism Type 1A due to a Novel GNAS Variant, with Congenital Hypothyroidism as the First Manifestation

Pseudohypoparathyroidism (PHP) type 1A (PHP1A) is a disorder of multiple hormone resistance, mainly parathyroid hormone. It is associated with Albright hereditary osteodystrophy phenotypes. Patients with PHP1A may initially present with hypothyroidism during infancy and later develop typical PHP1A characteristics during their childhood. Central precocious puberty (CPP) is extremely rare among PHP1A patients in whom gonadotropin resistance is more usual. This is a case report of a 9.5-year-old boy with congenital hypothyroidism who developed hypocalcemia secondary to PHP. He had relatively short stature with height standard deviation score of -0.9. Obesity had been noted since the age of two years. At the presentation of PHP, pubertal-sized testes of 10 mL were observed, and CPP was documented with serum testosterone concentration of 298 ng/dL (normal for Tanner stage III, 100-320), luteinizing hormone of 3.9 IU/L (normal, 0.2-5.0), and follicle stimulating hormone of 4.8 IU/L (normal, 1.2-5.8). Pituitary magnetic resonance imaging was unremarkable. Genetic analysis confirmed the diagnosis of PHP1A with a novel heterozygous missense variant of GNAS gene in exon 13, c.1103A>G (p.Asp368Gly). Awareness of PHP1A diagnosis in patients with congenital hypothyroidism and early childhood-onset obesity is important for early diagnosis. Apart from multiple hormone resistance, CPP may manifest in patients with PHP1A.

Sleep Disorder: An Overlooked Manifestation of Glucose Transporter Type-1 Deficiency Syndrome.

Glucose transporter type-1 deficiency syndrome (Glut1 DS) is a rare disorder with various manifestations. Early diagnosis is crucial because treatment with the ketogenic diet can lead to clinical improvement. Here, we report the cases of two siblings with Glut1 DS and one of them presented with sleep disorder which is a rare and atypical manifestation of Glut1 DS. Patient 1 was a 3.5-year-old boy who presented with paroxysmal loss of tone and weakness of the whole body with unresponsiveness after waking up. He also had excessive daytime sleepiness, insomnia, and restless sleep. His other clinical findings included focal seizures, paroxysmal exercise-induced dyskinesia (PED), ataxia, mild global developmental delay, and hyperactivity. Patient 2 was a 5.5-year-old boy who presented with drug-resistant focal epilepsy, global developmental delay, paroxysmal dystonia, and ataxia. A novel heterozygous nonsense variant of SLC2A1, c.1177G > T (p.Glu393*), classified as a pathogenic variant, was identified in both patients, but not in their parents' blood. After treatment with the modified Atkins diet, their neurological functions significantly improved. In conclusion, we reported two siblings with variable phenotypes of Glut1 DS with a novel nonsense mutation. Although sleep disorder and daytime somnolence were the nonclassical manifestations of Glut1 DS, the diagnostic evaluation of possible Glut1 DS in patients presented with daytime sleepiness, particularly in cases with the cooccurrence of seizures or movement disorders should be considered.

Gaucher disease: clinical phenotypes and refining GBA mutational spectrum in Thai patients.

BACKGROUND: Gaucher disease (GD) is a rare lysosomal storage disorder, characterized by hepatosplenomegaly and pancytopenia, with or without neurologic involvement. The disorder is categorized into three phenotypes: GD type 1 or nonneuronopathic GD; GD type 2 or acute neuronopathic GD; and GD type 3 or chronic neuronopathic GD. The purposes of this study were to describe clinical characteristics of Thai GD in patients diagnosed and/or followed up during 2010-2018 and to perform re-genotyping including analysis of GBA recombinant alleles which had not been investigated in Thai patients before. RESULTS: There were 27 patients from seven medical centers, enrolled in the study. All the cases had pediatric onset. GD3 (44.5%) was the most common phenotype, followed by GD2 (40.7%) and GD1 (14.8%), with one case of neonatal GD. The median age of onset for GD1, GD2, and GD3 was 72, 4 and 12 months, respectively, suggesting relatively earlier onset of GD1 and GD3 in Thai patients. All patients with GD1 and most patients with GD3 received ERT. Four patients with GD3 had ERT followed by HSCT. Patients with GD3 who received no or late ERT showed unfavorable outcomes. We identified 14 variants including two novel (p.S384F and p.W533*) and 12 reported pathogenic variants: p.L483P, p.N409S, p.R159W, p.P305A, p.A175G, p.D448H, p.V414L, IVS2+1G>A, IVS6-1G>C, IVS7+1G>C, IVS9-3C>G, and Rec1a. The p.L483P was the most prevalent allele found in this study, at 66% (33/50 alleles), followed by IVS2+1G>A, Rec1a, and IVS6-1G>C. Twenty-four percent of patients were reassigned with validated genotypes, most of whom (4 of 6) were patients with GD2. The [p.S384F + p.W533*] being compounded with p.L483P, was found in the patient with neonatal GD, suggesting that the p.S384F could potentiate the deleterious effect of the p.W533*, and/or vice versa. CONCLUSIONS: Neuronopathic GD was strikingly prevalent among Thai affected population. Homozygous p.L483P was the most common genotype identified in Thai patients. Recombinant allele Rec1a and splicing mutations were associated with GD2 and severe cases of GD3. Mutation spectrum could be useful for designing stepwise molecular analysis, genetic screenings in population, and new therapeutic research for neuronopathic GD.

Comparison of 24-Hour Recall and 3-Day Food Records during the Complementary Feeding Period in Thai Infants and Evaluation of Plasma Amino Acids as Markers of Protein Intake.

BACKGROUND: An accurate and reliable measurement of nutrient intake is the first and foremost step in order to optimise infant nutrition and evaluate its impact on health outcomes. However, research on the validity of dietary assessment tools used during the weaning period is limited, especially in lower-middle income countries. The primary aim of this study was to evaluate relative validity of a 24-h recall method (24-HR) using a 3-day food record (3-DFR). A secondary aim was to investigate association between protein intake from 3-DFR and plasma amino acids as a potential protein biomarker. Methods A multicentre, prospective cohort study was conducted in Chiang Mai, Thailand from June 2018 to May 2019. Food consumption data were collected in healthy infants using 24-HR and 3-DFR at 9 and 12 months of age. Blood samples were obtained at 12 months (M). Plasma amino acids were analysed using high performance liquid chromatography. Results Of 145 infants, 49% were female. At group level, paired t-tests/Wilcoxon signed rank tests did not show significant differences between average nutrient intakes from the 2 dietary assessment methods, except for vitamin A and vitamin C. Weighted kappa (Kw) was acceptable for all nutrients, except for vitamin A intake at 9 M (Kw = 0.15). The Bland-Altman analyses were unbiased for most nutrients with variable limits of agreement. At individual level, correlation coefficients (r) ranged from acceptable to excellent (r = 0.37-0.87) while cross-classifications showed acceptable outcomes, except for vitamin A. Multivariate analyses showed significant associations between protein intake at 12 M from the 3-DFR and plasma concentrations of branched-chain amino acids (BCAA) and essential amino acids (EAA), even after adjusting for gender, milk feeding type and energy intake. Conclusions For infants aged 9-12 M, a 24-HR can be used as a more practical alternative to a 3-DFR for most nutrients although caution is required for some micronutrients, especially vitamin A. A repeated interview might further improve the accuracy. Furthermore, protein intake, particularly animal-based protein, significantly predicted plasma BCAA and EAA concentrations regardless of gender, type of milk feeding and energy consumption.

Infantile onset Sandhoff disease: clinical manifestation and a novel common mutation in Thai patients.

BACKGROUND: Sandhoff disease (SD) is an autosomal recessive lysosomal storage disorder, resulting in accumulation of GM2 ganglioside, particular in neuronal cells. The disorder is caused by deficiency of ß-hexosaminidase B (HEX-B), due to pathogenic variant of human HEXB gene. METHOD: This study describes clinical features, biochemical, and genetic defects among Thai patients with infantile SD during 2008-2019. RESULTS: Five unrelated Thai patients presenting with developmental regression, axial hypotonia, seizures, exaggerated startle response to noise, and macular cherry red spot were confirmed to have infantile SD based on deficient HEX enzyme activities and biallelic variants of the HEXB gene. In addition, an uncommon presenting feature, cardiac defect, was observed in one patient. All the patients died in their early childhood. Plasma total HEX and HEX-B activities were severely deficient. Sequencing analysis of HEXB gene identified two variants including c.1652G>A (p.Cys551Tyr) and a novel variant of c.761T>C (p.Leu254Ser), in 90 and 10% of the mutant alleles found, respectively. The results from in silico analysis using multiple bioinformatics tools were in agreement that the p.Cys551Tyr and the p.Leu254Ser are likely pathogenic variants. Molecular modelling suggested that the Cys551Tyr disrupt disulfide bond, leading to protein destabilization while the Leu254Ser resulted in change of secondary structure from helix to coil and disturbing conformation of the active site of the enzyme. Genome-wide SNP array analysis showed no significant relatedness between the five affected individuals. These two variants were not present in control individuals. The prevalence of infantile SD in Thai population is estimated 1 in 1,458,521 and carrier frequency at 1 in 604. CONCLUSION: The study suggests that SD likely represents the most common subtype of rare infantile GM2 gangliosidosis identified among Thai patients. We firstly described a potential common variant in HEXB in Thai patients with infantile onset SD. The data can aid a rapid molecular confirmation of infantile SD starting with the hotspot variant and the use of expanded carrier testing.

Novel SOX10 Mutations in Waardenburg Syndrome: Functional Characterization and Genotype-Phenotype Analysis.

Waardenburg syndrome (WS) is a prevalent hearing loss syndrome, concomitant with focal skin pigmentation abnormalities, blue iris, and other abnormalities of neural crest-derived cells, including Hirschsprung's disease. WS is clinically and genetically heterogeneous and it is classified into four major types WS type I, II, III, and IV (WS1, WS2, WS3, and WS4). WS1 and WS3 have the presence of dystopia canthorum, while WS3 also has upper limb anomalies. WS2 and WS4 do not have the dystopia canthorum, but the presence of Hirschsprung's disease indicates WS4. There is a more severe subtype of WS4 with peripheral nerve and/or central nervous system involvement, namely peripheral demyelinating neuropathy, central dysmyelinating leukodystrophy, WS, and Hirschsprung's disease or PCW/PCWH. We characterized the genetic defects underlying WS2, WS4, and the WS4-PCW/PCWH) using Sanger and whole-exome sequencing and cytogenomic microarray in seven patients from six unrelated families, including two with WS2 and five with WS4. We also performed multiple functional studies and analyzed genotype-phenotype correlations. The cohort included a relatively high frequency (80%) of individuals with neurological variants of WS4. Six novel SOX10 mutations were identified, including c.89C > A (p.Ser30∗), c.207_8 delCG (p.Cys71Hisfs∗62), c.479T > C (p.Leu160Pro), c.1379 delA (p.Tyr460Leufs∗42), c.425G > C (p.Trp142Ser), and a 20-nucleotide insertion, c.1155_1174dupGCCCCACTATGGCTCAGCCT (p.Phe392Cysfs∗117). All pathogenic variants were de novo. The results of reporter assays, western blotting, immunofluorescence, and molecular modeling supported the deleterious effects of the identified mutations and their correlations with phenotypic severity. The prediction of genotype-phenotype correlation and functional pathology, and dominant negative effect vs. haploinsufficiency in SOX10-related WS were influenced not only by site (first two vs. last coding exons) and type of mutation (missense vs. truncation/frameshift), but also by the protein expression level, molecular weight, and amino acid content of the altered protein. This in vitro analysis of SOX10 mutations thus provides a deeper understanding of the mechanisms resulting in specific WS subtypes and allows better prediction of the phenotypic manifestations, though it may not be always applicable to in vivo findings without further investigations.

DUOX2 variants are a frequent cause of congenital primary hypothyroidism in Thai patients.

OBJECTIVE: To identify the genetic etiologies of congenital primary hypothyroidism (CH) in Thai patients. DESIGN AND METHODS: CH patients were enrolled. Clinical characteristics including age, signs and symptoms of CH, pedigree, family history, screened thyroid-stimulating hormone results, thyroid function tests, thyroid imaging, clinical course and treatment of CH were collected. Clinical exome sequencing by next-generation sequencing was performed. In-house gene list which covered 62 potential candidate genes related to CH and thyroid disorders was developed for targeted sequencing. Sanger sequencing was performed to validate the candidate variants. Thyroid function tests were determined in the heterozygous parents who carried the same DUOX2 or DUOXA2 variants as their offsprings. RESULTS: There were 118 patients (63 males) included. Mean (SD) age at enrollment was 12.4 (7.9) years. Forty-five of 118 patients (38%) had disease-causing variants. Of 45 variants, 7 genes were involved (DUOX2, DUOXA2, TG, TPO, SLC5A5, PAX8 and TSHR). DUOX2, a gene causing thyroid dyshormonogenesis, was the most common defective gene (25/45, 56%). The most common DUOX2 variant found in this study was c.1588A>T. TG and TPO variants were less common. Fourteen novel variants were found. Thyroid function tests of most parents with heterozygous state of DUOX2 and DUOXA2 variants were normal. CONCLUSIONS: DUOX2 variants were most common among Thai CH patients, while TG and TPO variants were less common. The c.1588A>T in DUOX2 gene was highly frequent in this population.